Give me a job.

[Pimp]

you who find yourself reading this post while wondering how you will fill that position to get all the work done in time for xmas, worry no more just give me a job and all will be well.

[Clevis Hitch]

I got a job for you...

[lena_chita]

you who find yourself reading this post while wondering how you will fill that position to get all the work done in time for xmas, worry no more just give me a job and all will be well.

Sure, could you optimise RRBS protocol for me? If yes, you can start tomorrow morning with the methylated adaptor ligation.

[DriskellHR]

my taint could use a wash.

[Pimp]

Reduced representation bisulfite sequencing (RRBS) is a protocol for
determining the methylation status of hundreds of thousands of CpG dinucleotides in an MspIdigested
genome. Genomic DNA is first digested with MspI, which cuts at every CCGG site
regardless of methylation status. The fragments are end repaired and an adenosine is added to 3’
ends. Next, a methylated version of the illumina paired-end adapters is ligated onto the genomic
DNA. Fragments of adapter-ligated DNA ranging from 105 to 185 basepairs are purified using
gel electrophoresis and subsequently treated with sodium bisulfite, which converts unmethylated
cytosines to uracils and leaves methylated cytosines unchanged. Bisulfite treated DNA is then
amplified in a final PCR reaction (converting uracils to thymidines). The sample is then ready to
be sequenced on the Illumina Genome Analyzer.

Illumina Genome Analyzer sequencing requires that cytosines within the adapter sequences be maintained. We use Illumina adapters that contain 5-meC instead of C to prevent deamination during the bisulfite reaction [18]. Adapter oligonucleotides are annealed at a concentration of 15 µM in 10 mM Tris-HCl, pH 8, 0.1 mM EDTA and 10 mM NaCl by heating to 98 °C for 5 minutes in a heat block followed by a gradual return to room temperature. Klenow treated DNA fragments are reacted in 50 µl reactions containing 2.5 µl of 15 µM annealed Illumina adapters, 1 µl of 400 U/µl T4 DNA Ligase (NEB), and reaction buffer. For sample containing less than 1 µg of DNA, we use 1 µl 2000 U/ul concentrated T4 DNA ligase (NEB) in a 20 µl reaction to maximize the ligation efficiency. The reaction is incubated overnight at 16°C, stopped by 1 µl 0.5 M EDTA and purified by phenol:chloroform extraction. Samples are eluted in 10 µl Tris-HCl (pH=8.5).

Qiagen Dneasy Blood and Tissue Kit (Qiagen 69581)
ilAdap Methyl PE1 (IDT: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T; all C’s are
methylated, *=phosphorothioate bond)
ilAdap Methyl PE2 (IDT: GATCGGAAGAGCGGTTCAGCAGGAATGCCGA*G; all C’s are
methylated, 5’ phosphate, *=phosphorothioate bond)
MspI includes NEB Buffer 4 (NEB R0106L)
Klenow fragment (3’ to 5’ -exo) (NEB M0212L)
Qiagen MinElute Kit (Qiagen 28004)
T4 DNA ligase (400 U/μl) and buffer (NEB M0202L)
Lonza NuSieve GTG agarose (Fisher BMA50080)

[DHB]

So if anyone has a job that involves Googling with advanced copy/paste skills, this is your guy.

[dustonian]

Ah, epigenetics... it all sounds so complex with those big made-up words. But come on, few things in the world are really rocket science... not even rocket science. I'm sure he could be trained easily enough... admittedly not in time for the holidays tho. Brain surgery, on the other hand...

[lena_chita]

Reduced representation bisulfite sequencing (RRBS) is a protocol for
determining the methylation status of hundreds of thousands of CpG dinucleotides in an MspIdigested
genome. Genomic DNA is first digested with MspI, which cuts at every CCGG site
regardless of methylation status. The fragments are end repaired and an adenosine is added to 3’
ends. Next, a methylated version of the illumina paired-end adapters is ligated onto the genomic
DNA. Fragments of adapter-ligated DNA ranging from 105 to 185 basepairs are purified using
gel electrophoresis and subsequently treated with sodium bisulfite, which converts unmethylated
cytosines to uracils and leaves methylated cytosines unchanged. Bisulfite treated DNA is then
amplified in a final PCR reaction (converting uracils to thymidines). The sample is then ready to
be sequenced on the Illumina Genome Analyzer.

Illumina Genome Analyzer sequencing requires that cytosines within the adapter sequences be maintained. We use Illumina adapters that contain 5-meC instead of C to prevent deamination during the bisulfite reaction [18]. Adapter oligonucleotides are annealed at a concentration of 15 µM in 10 mM Tris-HCl, pH 8, 0.1 mM EDTA and 10 mM NaCl by heating to 98 °C for 5 minutes in a heat block followed by a gradual return to room temperature. Klenow treated DNA fragments are reacted in 50 µl reactions containing 2.5 µl of 15 µM annealed Illumina adapters, 1 µl of 400 U/µl T4 DNA Ligase (NEB), and reaction buffer. For sample containing less than 1 µg of DNA, we use 1 µl 2000 U/ul concentrated T4 DNA ligase (NEB) in a 20 µl reaction to maximize the ligation efficiency. The reaction is incubated overnight at 16°C, stopped by 1 µl 0.5 M EDTA and purified by phenol:chloroform extraction. Samples are eluted in 10 µl Tris-HCl (pH=8.5).

Qiagen Dneasy Blood and Tissue Kit (Qiagen 69581)
ilAdap Methyl PE1 (IDT: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T; all C’s are
methylated, *=phosphorothioate bond)
ilAdap Methyl PE2 (IDT: GATCGGAAGAGCGGTTCAGCAGGAATGCCGA*G; all C’s are
methylated, 5’ phosphate, *=phosphorothioate bond)
MspI includes NEB Buffer 4 (NEB R0106L)
Klenow fragment (3’ to 5’ -exo) (NEB M0212L)
Qiagen MinElute Kit (Qiagen 28004)
T4 DNA ligase (400 U/μl) and buffer (NEB M0202L)
Lonza NuSieve GTG agarose (Fisher BMA50080)

Nice job on doing the search, even if the protocol is a bit out of date!

Now, back to my question...